Blastocladiella emersonii clone report

Clone ID BeCSAS2356
Best BLASTX Match emb|CAB52882.1|
Function Description SPCC830.09c [Schizosaccharomyces pombe]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2356
CATCAATTTGCCATGTATGCCTTGCCATGACCATGTAACGAGTAGATGCA
ACGTGCCGCTGACCCGCGTGTCTCCCATAATCCAGTGTCATGGTCCGCTA
CAAGTACCGGTACCTCGTCTTCTCGCTCGACTACGGGCAGGACAATACCG
TCGACACGTCTGTGACGCAGGAGGACTTCGAGCGCCGGATCCGCGCCGCC
GTCGAGATCCATTTCGGCCCGCACGGGCTCGGGCTGGTCCTGTCCAACTT
CTCCGTCCGCTACTTTAGCAGCTTCACGGGCATCGGCGTCGCTCGTGTCG
GCCGCGACTACTACCGGACGCTGTGGGGCGCGCTGTCGCTCATTACCGGC
TTGGGCGGCGCGCACAAGTGCCGGCTGCTCGTCCTCAACTGCAGCGGGAC
CATCCGCAAGTCGCAGATCGCCGCGCTCAAGCACGACCGCGCGCGGCTCG
CCGTCGCGCTGCACCGGTTGCAGAGCCAGGGGTCCGGTGCGGCGAGCGTC
GTGGATAAGATTGCGGCTGAGAACGAGGCGCTGATTCGGACAATGGATAT
GGCGTAAGAAGTAAGTAGTAAGT