Blastocladiella emersonii clone report

Clone ID BeCSAS2354
Best BLASTX Match ref|XP_780136.1|
Function Description PREDICTED: similar to protein expressed in T-cells and eosinophils in atopic dermatitis [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2354
CGAGGGCACCACTCCGCACACCACCACGTAAGCAAACGCATCGAGCAACT
CAGCGCAACCGCTAGCCAGCATGGGAGTCATGTCCAAGGTCCTGGCGCTG
CCCGTGCACATTGCCACGTCGCTGTACGCCATCCTGGCGACGCTCCTCCC
GTTCCTCCCGCAGCTGGCGCGGCGGCACGCGCTGCTGTCGGACGGCTCCG
CGGCGGGCTACGAGCGGGCGGTGGCGCGGTACGAGCGGCTGTACACCCCC
GAACACCCGGCCTTCTACCGCGGGTCGTACAAGCAGCTGGTTGACGACGT
CAAGGCCAAGCTCGAGCTCGCGCTCGTGTACCTGCACAGCGACGACCACG
ACGACACGCTGCGGTTCGCGCGCGAGTCGCTGGCCGCGCCCGACCTCGCC
GCGCTGCTCGCCGAGTTCAAGGTCAACCTGTACTTTGGGCCCATGGACCA
GCCCGAGCCGTTCGAGATCGCCGCGCACCTCGGCGCGACCGCGTTCCCGT
TCCTCGCCCTCATCACCTTGCAGAGCGTGAATGGCGTCGTGAAGCCCACG
GTCGTGTTCCGCAGCGAGGGGTGGGTCGCACCCGATACGCTCGTCGCCAA
GCTCCGCGACGCGATCCAGACCCACGGCTTGTTCCTCGCCACGGTCCGCC
ACCAGCGCGAGCAGCAGGACGCGGACCGCCGTATGCGCGCGATGCAGGAC
GAGGCGTACCAGGCGTCGCTGCAGCGCGACATGGAGCGGCAACGCGAGCA
AGAACGCGCCGCGGAAGCCACGCGCGCGGCCGAGGCCGCCAAGTCGGCGC
GCCGGACCGAGCTGGCGCAGGAGCTCCGCGACCGCAAATCGCGCCGCGCG
GCTGCGCGCGCGTCGCTCCCCGCCGAGCCCGACACCGCGACCGCTGGGCG
CACGGTGCTGCAGTTCCGCCTGCCCAACGGGTCGCGCGTGCGCCGCGCGT
TCCGCGACGCCGACCCCGTGCGCGCCCTGTACGAGTACGTCAGCACGCTC
GACCCGCTCGGCGAGGACGATCTCGACGCGGACGAGTGGGCTGAGGCCAA
GATCAAGGCGGAGGAGGCGGGGGCGAGTAGTAGTGAGGAGGAGGATGAGG
AGGAGAGCGTGGTGCAGCCGTTCGGGTTCCTCCTCGTCGACGTGTTCCCG
CGGCGCGAGTTCCGCGACGTGGACGCGACGCTGGCCGGGGCCGGGCTGCG
CGGCGGGAACCTCGTGGTCGAGGTCTGAGGTTTACGGCAGAGCAACAATA
CATTCTATTTCATTC