Blastocladiella emersonii clone report

Clone ID BeCSAS2352
Best BLASTX Match ref|ZP_01230409.1|
Function Description hypothetical protein CdifQ_02002769 [Clostridium difficile QCD-32g58]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2352
GTCCGCGCATCAACAACCATGTCGTCCCCCCTCAACGTCGTCCACACCGA
GCAGGCCCCCGCCGCCATCGGCCCCTACTCCCAGGCCGTCGTCGCCAACG
GCATGGTGTTCTGCTCGGGCCAGATCCCGCTGGTCCCCGAGACGATGCAA
ATTATCGAGGGCGACGTCAAGGCGCAGACGCGCCAGGTGCTCGTCAACCT
CAAGGCGGTGCTCGAGGCCGCGGGCTCGGACCTCAACCACGTCGCCAAGA
CGCTCGTCTTCCTCAAGTCGATGAACGACTTTAACGCCGTCAACGAGGTG
TACGCCGAGTTCTTCGCCACCCACAAGCCCGCCCGCGCCGCCGTCGAGGT
CGCCCGCCTGCCGCGCGACGTCCAGGTCGAGATCGAGTGCGTCGCCGTCG
TCAAGAAGCAGTAAGCGCCTGTCTCGGGCGCGCTTGCCGCCTAAATACAC
CACCCTTCTCCCCGTGCAATCC