Blastocladiella emersonii clone report

Clone ID BeCSAS2351
Best BLASTX Match ref|XP_382126.1|
Function Description hypothetical protein FG01950.1 [Gibberella zeae PH-1]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2351
CGCACGCCTCCCTCCCCTCCTCCTCTTCCCTCGAAGAACTAGTCGGTTCC
TGTTGCCCACGCCGATACACCCCACCATGTCCGTCGTTGGTATTGATTTC
GGTAACCTGCAGACGTGCATTGCCGTCGCCCGCAACCGCGGCATCGACAT
CATCTGCAATGAGGTGTCGAACCGCTTCACCCCCTCGCTCGTCGGCTTCG
GCCCCAAGTCGCGCCACCTCGGCGAGGGCGCCGCGACGCTGCACGTGTCG
AACCTGAAGAACACGGTCAGCTCGCTCAAGCGCCTGGTCGGCCGCCCCGC
GACGGACGCGACGCTCGCCAAGGAGCGCGAGTACACGACGGCCAACATGG
TCGCGTCGGACCCGTCCGTGTCGCCGTCGGGCGAGATCGGCGTGCAGGTG
CAGTACCTCGGCGAGGAGCGCACCTTCTCGGCGACCCAGTGCGCCGCCAT
GTACCTCGGCAAGATCAAGCAGATCACCGAGCACGAGCTCAAGGCGCCCG
TCTCGGACGTGGTCGTGTCGGTCCCCGTGTGGTTCTCGCCCGCCCAGCGC
CAGGCCATGATCGAGTCGTGCGAGATTGCCGGCCTCAACCCGCTGCGCAT
CATCAACGACACCACCGCCGCGGCCCTCGCCTACGGCATCACCAAGACGG
ACCTGCCCGAGGAGACCCCGCGCAAGGTCGTCTTCGTCGACGTCGGCCAC
TCGTCGACCTCGATCGCCGCCGTCGCCTTCGTCAAGGGCAAGCTGCAGGT
CAAGGCCACCACCGCCGACCCCTTCC