Blastocladiella emersonii clone report

Clone ID BeCSAS2350
Best BLASTX Match ref|XP_760610.1|
Function Description hypothetical protein UM04463.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2350
TTTTTTTTTCTTAATAAAAACCTGCGTGTTTATACCATCCCACCGCCTCG
ACCACGATCGCGCACAAGCACGTTAGAAGTGCTTGTAGTCGCGCTTACCG
CCGCCCCTCGACGGTCCGTTGACGGCCTGGAGGGCAAAGTAGGCGACGCC
GGCGATGGCGAGGAGGAAGAAGAAGATGAGGAGGTACGGCGGGCCGGACG
CGTCGGGGACCATGAAGGACGAGTTCCAGTGGTTGCGCTGGTCCGGGTTG
ACGTGCGAGTTGTCGTCCTTGACGATCTGGTTGGTCGAGACCGAGATGAT
GTCGTGGTTGTCGGACAGCCCGCCCGTCTCGCCGTAGAAGCTGTAGTACC
CGGGGTTCGGCAGCGTGACGTTGTCCACGGAAATGCACGTCGTCCAGTCG
TCCCACCCGCGCGTGTTGAGCTCGACGCGGAGGTACTTGCCCTTGATGTA
CCGAACGCGGGCGCGCGTCGCGTAGTCCTTGTTGCGGATATCGGCCTCGC
ACCCGCCGAGCTCGATCTCCTTGCCGTCCGTGTCCTTGTTGTAGGTCTGG
GTGCCGTCGTTGTGCAGCGCGGCCACGTACGGGTACGTGTACCCGTGGCG
CCCGTTGTCGTACGTGTCGAAGACGAGCGCCAGCCCGTGCCACTTCTCGG
GC