Blastocladiella emersonii clone report

Clone ID BeCSAS2348
Best BLASTX Match ref|XP_656852.1|
Function Description conserved hypothetical protein [Entamoeba histolytica HM-1:IMSS]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2348
CACCACGCGTCCGCCCACGCTTCCGCTCATCCAAAATGGCCGGCAAAATC
TCCACGGGCGCCAAGAAGTCGGGCCAAAAGTACCAGAACACGACGGCGTT
CCGCCACAACAAGGCGTCCAAGAAGACCAAGGTCATTCTCGGGCTCCCGA
TCCACGGCCTGTGCGCCAAGTGCTTTGATGTCATCGAGTGGCGGAAAAAG
TTCCGCAAGTACAAGCCGCTGACGGCGCCCAAGAAGTGCGTCACCTGCAA
CCAGAAGACGGTCAAGGACGCGTACCACGTCATGTGCACGCCGTGCGCCA
CCGACAAGGGTGTGTGCGCCAAGTGCCTCGAGTCCAAGGAGATTGTTGAG
GGCGTCAACACCATGTCCGCGGCCGACATGAACGCGCAGCGGCAAGAGTA
CGAGATCAAGCTGCGCATGCTGACGGAGCGCCAGCGCCGCACCTTCCTGC
GCAAGCTCGACCGCGGCGAGGTGTCCGAGGCCGACCTGCTCGCCATGGAC
ATCAAGGACCGGACAGACGACATGTGGGGCTTTTCGTCCGACGAGGAGGA
TGACAGCGAGGATGAGGAGGGCGACGAGGAGGAGTCTGACGACGAGTAAT
CGCGACCAAGAGCGCAACGCGGCACCACTTTTTTATACACACGCTCATGT
AGTTNTTAAAAA