Blastocladiella emersonii clone report

Clone ID BeCSAS2347
Best BLASTX Match gb|AAW47109.1|
Function Description conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2347
GCGGGCGACGCCGAGGTGATCAAGATCGACGAGAACGGCGAGGAGCACCA
CTTCCGCCCGCTGCACAAGGGCAACTATTTCGGCGAGCTCGCGCTGCTCT
CGGACAAGCCGCGCGTCGCCACGATCCGCGCCAAGGGCAAGCTCAAGTGC
GCCACGCTCGGCAAGAAGGCCTTCACCCGGCTGCTCGGCCCGCTCGCCGA
CATCATGCAGAGAAACACCCAGGAGTACGAAAAGTATCCCGGCGAGCACT
AAGTGCGCGCGGGGTCGCGTCGGTGTCGGTTTGTCCTGGTTACCCTACCA
TGCCCTGTCCCCCCCCTGTCCTTTGAGGCCACCTCTTTGTGATTTATCAG
TTACGCAATGAATGAAGAAGATGTTTGAAATCTGACAATCAACCCTTGTA
CTCGGTAAAGTTGCTGTGCCCCGAGACGAGGGCGTGCTCGAGCGCCGCGG
CCTGCCCGCGCAGCCCGACGCCGCATTCGGCGCAGCTCAGCGTGAAGTTG
GCCGTGTCCGTATACCGGTGCGCCTTGTGCAGCTGCCCCGCGAGCTGCAC
CGCCGACTCGAGCAGCTTCGTGCTCGCCACGGGGAACACGGTCGCGTCGA
ACTCGCGCGGCGATTCGAGTGACGGGGCGAGGCCGAGCGCGTCGTAGTGG
ATCGAGTTGTACACGACAAACGCGCGCTTGTCGTACTGGCCCTCGCCGAA
CCGGTCGATGCGCATCGTCAGCACGTCGACCGAGCAGATCTCGGTCTGGA
AGTGTTTTGCGAAGATGGCCAGCTCGATGGCGCCGCCCCACGCCTGCGAC
TTGCTCAGCCACGCGCAGTACTCGTCGACGGGCCGTCCCAGCACCGCCTC
CGTGTACGTGTCCACGTTCTCCTTGATCGTCCGGACCGCCAGCATCCGCA
GCTCGTGCGGCGTCATGGCGCCGCGCGTCACCACGTACGCGATGCTGTGG
AACAAACAGCTGTTGTCGTCGGGACTCTGCCGCAGGATCAGGTACCCGTC
GTGGTCGGGAACGTGCACGAACTCGCCCAGTACCACGTCCGACGACGGGT
TGAAGTCGGACGCGGCGGGGGTCGAGGGTTTTGGTGCAGCGGCGACGGGC
GCAGGTGCGGGTGCAGGCGCGGGCGGCCCGATATCCGACGGCCGGACGCG