Blastocladiella emersonii clone report

Clone ID BeCSAS2345
Best BLASTX Match ref|XP_386355.1|
Function Description hypothetical protein FG06179.1 [Gibberella zeae PH-1]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2345
GAGCGGCCGGCTAAACCGACGGCCTTCTTCTACTTTGACCTCGACGGCAC
CGTGTACTCGCACGGGCGCGGCGTGCTCGACGAGATGCGCGACCTCATCC
AGGCGTACTTTGCGCAGCACCTCAGCCTGACGCGCGACGAGGCCGTCAAG
CTGCAGAAACAGTACTACCTCCAGTACGGGCTCTCGATCCGCGGGCTGCT
CAAGAACCACCACGTGGATCCCGTCGACTACGACCAGAAGGTAGACCAGG
CCGTGAACCTGCCCAAGTACGTGCAGTCGGACCCGGAGATGCGCGCGATG
CTGCAGCGGCTGCGGCCCGATATCGTGCGGTGGGCCTTCACCAACGCCGG
CATCCAGCACGCGCGCCGGGTCCTCGACCTCGTCGGGATCAGCGACATGT
TCCACGGCATGACGTACTGCGACTACACGCGGCCCAACTTCTCGTGCAAG
CCCGAGCCCGAGTTCTACGAGCAGGCGTTGCAAGAGTCCGAGTACGCGCG
CGCGGGCATCCCCGTCTACTTTGCCGACGACAACCTGCCCAATCTGACGG
CGGCCAAGAAGCGCGGGTGGGTCACGATCTGGATCGACCTCGAGCGCCGG
TCGCACGCGGACGCGGACTTTACGATCGCCGACCTCAAGGAGCTCCCGTC
GATCCTTCG