Blastocladiella emersonii clone report

Clone ID BeCSAS2341
Best BLASTX Match gb|AAK84438.1|
Function Description chitin deacetylase [Blumeria graminis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2341
TCCGGTCCGGAACTCCGGGTCGACCCCGCGTCCGGCAGGCCCTGCTCAAG
CGCCAGTACGCCGAAGGCCATCACGTAGCATCGCACACAAACACGCATGC
CGATCTCGCGACCCTCACGACGGCCCAGATCCGCGACGAGCTGTTCAAGA
CCGAGGCCGTGATCAAGTCGGCCATCGGCCTGGTGCCCAACTACATGCGC
TGCCCGTACGGGTCCATCACCGCGTCGGGCGCCGCGTACATCCAGTCGCT
CGGGTACAAGATGATTTACTGGAACTTGGACTCGCTCGACTGGCAGAGCC
AGAACGCGACGGCGGTCATGGGCGAGTACAAGGCCGTCATGACGTCCCCG
GCCGTGTCGTCGACGGCCGGTATAATTTCTCTCCAGCACGATATCCAGGC
CGTGACGGCGGGCATGATCGAGCAGGTGCTCGACTTTATCACGGTGACCA
ACAACCAGGTGATCATGACCACGGGCGACTGCCTGGGCGACCCCAAGACC
AACTGGTACCGCTCGGCGCTCCGGACCTGATCGCGCCGTGGTCTCGGTCT
GTATACCCCTCCCTCTGCTTCTTGTACTGCCCTCGTATTCGCCGTCCTGC
GCAATTTACGATAGCCTTGGTTTGACG