Blastocladiella emersonii clone report

Clone ID BeCSAS2340
Best BLASTX Match gb|AAH86735.1|
Function Description Zgc:101763 [Danio rerio]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2340
CTGCAATGGATCTCTAACTACCGGAAACATGCGCCTCAAGATCTTGAACA
ACGCTAGCGGCCACTCGGAGCTTGTGAGCTGCCTCGGATGGTCGTCCGGA
AGCGAACTGTATACTCTCGGCGAGGACCAGAAGCTCCTGCGATGGTCGCA
CGAGGGCGAGTGCCTCGGCCCCGTCCCGACCAACCTGTTCCCGTCCGCAT
CAGCGACGGCGGCGCAGGGCAACGCGGCTCGGGTAACCATCTACTACACG
GCGCTCCACTGGTGCCCGGGCAAGACGGACGTGTTTGCTGCGGGAACGAG
CGACGGCAAGGTGATGCTGTGCAGCAAGGGCGCGCGCGTCGATAAGGTCA
TCGAGGCGCACCACGGCGCTATCCTGTCGCTCGCGTGGTGTAACGATGGG
ACTGCACTGCTCTCTGGCGGCGAGGATGGGATCATCAAGATCTGGTCCAA
GTCGGGTATGCTGCGGTCGACCTTCATCACCCAGAGCTCTCCTGTCTTCT
CGGCTGCGTGGTCCGCCGACGGAAGCCAGATCCTCTTCACGACCAACCGC
TCGCTCTCCGTGAAGCCGCTTCAGGCCGGGACCAAGACGAACACGTGGAA
GGCGCACGAGGGCGTCATCCTCAGGCCGTGTGGAA