Blastocladiella emersonii clone report

Clone ID BeCSAS2339
Best BLASTX Match gb|AAZ75690.1|
Function Description TSGA2 [Mus spretus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2339
GTCCGCACGAAACTCCGCTACGAACCAACCCCACGCATTGCTACCAGCTA
CCATGTCCGACGCAGGATCCGACGTTGACCCGCAGGAGCAGGCGCCGACC
ATCGGGACGTACGAGGGCGAGCGCATGGCGACGGGCGAGCGGCACGGCAA
GGGCCGGAACACGTTCCCGAACGGCGACATTTACGAGGGCGAGTACTCGG
TCGGCCGGCGCGAGGGCACGGGCACCTACACGTGGAAGAAGCCGCGCGCG
CTGTACGTCGGCGGGTACCGCGCCAACGTGCGTCACGGCGCGGGCGCCAT
GGTGTACCCGGACGGCGGGCGGTACCGCGGCGAGTGGGCGCTGGGTCGGC
GGCACGGCGCCGGGCTGTACGTGTACCCGAACGGCGACACGTACGACGGC
GAGTGGGCCGAGGACCTCAAGCACGGCAAGGGCGTGTACACGTTTGCGGC
GACGGGCAGCCGTGTGGCCGGGACCTGGGACAAGGGGTTTTTGTCGGGGG
CGGCGGAGATCGCGCACCGCGACCACGTCGTGCGCGGGAACTACACGCAC
ATCCGCGAGTCCGTGCCGGTGAACCCGGACGACGACAGCGCAGGGACGGT
CGAGGTCGTCAAGGCCGCCAAGCTCGAGCTCCCGTGCGCAGTCGAGTTCA
AGAAGTCGGGCCACGTTGTGCCGTCGTGCTGGGT