Blastocladiella emersonii clone report

Clone ID BeCSAS2338
Best BLASTX Match dbj|BAA93675.1|
Function Description Ser/Thr protein phosphatase 2A regulatory subunit A [Lentinula edodes]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2338
GCGTCCGCCTGCTCGCGCTGTTCCTGCAGCTGCTCAAGGACGAGTTCTCG
GAGGTGCGCCTCAACCTCATCTCCAAGCTCGAGCACGTCAACCACGTGAT
CGGGATCGAGTTCCTCGCGCAGTCGCTGCTCCCCGCGATCGTCGAGCTCG
CCGAGGACCGCCAGTGGCGCGTGCGCGCGGCCATCATCGAGTACATGCCG
CTGCTCGCGCAGCAGCTCGGGCAGCAGTTCTTCAACGACAAGCTCGGCCC
GCTGTGCATGACGTGGCTCGGCGACCCCGTGTTCGCGATCCGCGAGGCGG
CGTGCGTCAACCTGCGCAACCTCGCCCGCGTGTTCGGCAACGACTGGACG
CGCGACGTGCTGCTGCCGCAGGTCACGGGCATGACCACCCACGCCAACTA
CCTGTTCCGCATGACCACCGTCATGGCGCTCACCACGCTCGCCCCCGCGC
TGTCCGAGGAGCTCCTGCGCGACCCCGTGCTGCCCTCCATCACCACGCTC
GCGCACGACCCGATCCCCAACATCCGGTTCAACGTGGCCAAGGCCATCGA
GGCGCTGCTCCCGACGCTCCGCGCCGCCCAGGTCGCCGAGCTCGTCGTGC
CGCTCCTCCAGAAGCTCGGCGGCGACGCCGACGCCGACGTCCGGTTCTTT
GCCGGCAAGGCCATGGCCGGCGTCTCGGCCGCGTCCGCTGCC