Blastocladiella emersonii clone report

Clone ID BeCSAS2335
Best BLASTX Match ref|XP_758693.1|
Function Description hypothetical protein UM02546.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2335
GCGTCCGCAACGAAGCACACGCATCAACCCTGTCGTCGGCCCTGCACCGA
CGCACCCCCCTCTACCCCTACACTTCACCAACCCACCATGGGCGCCGACT
GCTGCGGCGGCGACACCGGGTCGCGGCACGACCCGCACGCGGCGAGCCGC
GCTCTGGCGCACGCCGAGGCCGAGGGGCTCGTCAGCAAGGACCTCAAGGC
ACGGCTCGAGCGGGTCGCGGCGTACCTGGGCGACGCCAAGCGGTCGGGGG
TGCGGATCCACGGCGGCGTGCTGAACGGCACCCGCGTGAGCTACTTCCGC
GGCAAGCACGCGGTGGCCGCGCTCGATAAGGAAGTGGCCGAGGGGATGGT
CCTGCGCGATGCGGATATTCCGCACGACCACGAGCACGACCACGACCACG
AGGACGCGGTCTGTGACGCGCACCAGCCGCTGTCCAAGGCCGACCGGATC
ACGGCGACGCTCGAGACGCTGGTCCTGCACGGCCTGATCGTGCGCGTCGA
CAAGCACCCGCAGCAGAAGAAGGTGGTGTCGATCACGGCGCTGCAGTCGT
TCGACCCCGCCGAGTACTACGTGCTGGCGTACACGCCGCACTCGCTGTTC
ATGACCTTTGCCTCGCTCGGGCTCGTCGCGGTCGTCCTCGCCGGCGTCAT
GTTCCCGCTGTGGCCCGAGCCGCTGCGCGTCGGCGTCTCGTACCTGTCGT
ACGCGATTTTGGGGCTGCTCGGGGTTCTGTTCGCGCTCGCTATCGCCCGG
CTGGTGGTCTACGGCGCCCTGTACGCGGTCGGCAAGCCCGGCTGGCTGTT
TCCTAACCTGTTCGCGGACGTCGGGATCCTCGAGTCGTTTGTGCCCGTGT
GGGAGTGGGAGTCGTCGACGGCCGCGGCACCAGCGGACGCGAAGCCCAAG
TCGGAGTAGTAGCAGTTGTCGTGATTCCCCTCTTCCTCATGTCCCCCTAC
GCATATACATTTGTCCTCCCC