Blastocladiella emersonii clone report

Clone ID BeCSAS2333
Best BLASTX Match ref|XP_759470.1|
Function Description hypothetical protein UM03323.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2333
CGCGTCCGGTGCCGGTCGACGCTCAAGTGGACGTACGCGCTCGCCTTCTA
CATGAACCGCAACAACATGACCGAGCTGTTCGAGGCCAACCAGCGCGACC
TCGAGATGGCCGTCGAGGCGCTGTCGGGCATGCTCGAGTCCGAGGACCTC
GTCGACCCCGACAAGATCGACACGGTGCGCCGCGCCATCATCGACAAGAC
CGTCTACGTGCAGTCGCGCCGCGAGGTGGTGCTCACCGACACGGCCGCCG
GCCTGCGCGAGGGCCGCTGGGCGTGGACGCCGCGGCCATGAGCGGCGGGG
GCGGCGGCTCGGAGTCTGTCATGTCCTGTGTGAATGTGAACGGATCTTCT
TTG