Blastocladiella emersonii clone report

Clone ID BeCSAS2328
Best BLASTX Match gb|AAH96507.1|
Function Description LOC613054 protein [Xenopus tropicalis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2328
GCCCGCATGCAACGGATCAGCACCATGCTACGCTCCACCATGTCCCGCGT
CGCCGGCGCCCTGCTGCGCCGCCGCGCCGCTGCCGCCGTGACCGCGCGTC
CCGTCGCCGCGGCTCCCGCGATCGCTGCCCGCCGCTCGTACGCCTCGGGC
TCGACCGCTGAGCAGAGCCTGCTCACCCGCATCGAGAAGAAGCGCCAGGA
GGCCCTCCTCGGCGGCGGCGAGAAGCGCATTGCCGCGCAGCACGCCAAGG
GCAAGCTGACGGCGCGCGAGCGCCTGACCCTGCTCCTCGACGAGGGCTCG
TTCCGCGAGTACGACGCCTTCGTCGAGCACACGTGCGCCGACTTCGGCAT
GGAGAAGACCAAGATCACGGGCGACGGCGTCGTCACCGGCCACGGCACCA
TCAACGGCCGCCAGGTCTTTGTCTTCTCGCAGGACTTCACCGCCTTCGGT
GGCTCGCTGTCCAAGACCCACGCCGCCAAGATCTGCAAGGTCATGGACAA
GGCCATGCTCGTTGGCGCCCCCGTCATCGGCCTCAACGACTCGGGCGGTG
CGCGTATCCAGGAGGGCGTCGAGTCGCTCGCTGGCTACGCCGACATCTTC
CAGCGCAACGTGCTCGCCTCGGGCGTCGTCCCGCAGCTCTCGCTCATTAT
GGGCCCCTGCGCCGGCGGTGCCGTCTACTCGCCCGCCCTCACCGACATGA
CGTTCAT