Blastocladiella emersonii clone report

Clone ID BeCSAS2326
Best BLASTX Match ref|XP_762256.1|
Function Description hypothetical protein UM06109.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2326
TTTTTTTTTAACGGTTGGAAGAAATCAATCAAGACACACACACACAAACG
GCGGGGGCACCCCCCTCTCATCACAGCACACGCACCGACGCGCCCGCCGC
CACCGCCACCCACCCACCCGTCCAGCGCGCGCTCTCTCCCTCCCCCCTCC
CGCTCCCGCTCGCTCTCTCGTAGCAAGACTCGCTGCAACCGTGCTCTCCA
TCGCACGCATCCACCCTTGACCTGCTGTCGCTACCGCCGCCCGCCGCCGC
CGTCGTCGTCGTACACTCGCAGCGCCAGCGCCAGCACCTTCCTCAACCGC
AGCAGCAGCCGTCGTCGTCCGTCACGCAGCCGCTCCTGCACCATCATCCT
CGGTCGCAGCACCAGCAGCACCAGCGATCCGCCCCGCGCCTCGCGTCATC
CTCGTCGCTCAGCCGTCAAGGAGCAGCGCCAGCAGCAGAGCCACACGCGT
CCGCTTCGTCGCCGGCCCTCTCGTCCTACTCGTCGTCGGCGTCGCTCACC
TCGCGCCCACGGCCACCACAACCCCGCCCCGCCGCCGCCACCTCCGTCTT
CTCGCCCCGCACCGCGACCGCCATGTCGGAACTCAAGCTCAAGAAGCTGC
TCGAGCTCAACAACCGGCTCAAGGAGCAGCTCGACATGCCGCGGCTGACC
GTCTCGGACGCGTCGCAGTCGCTCATCAAGTACGTCAAGACCACCAAGGA
CTACCTGGTGCCCTCGGTCTGGGGCACCGTCGACAAGAAGGAGGACCCCT
ACGGGCCCATGGGCGGGCCGTGCGCGTGTACCATTGCGTAGGTGGACCCC
TCTCTCTCCCTTGCCCTGCCCGCGTCGTGTCGGGTGGGTGCTGTGATGAG
AGGGGGGTGCCCCCGCCGTTTGTGTGTGTGTGTCTTGATTGATTTCTTCC
AACCGTTTACCCTCCCCTTCCGCTCGCTCGTCTCGCTGTCGTCGTTGCTC
TCTCGTGTCGCCCTCGTACCCCTCCCTCCCTCGC