Blastocladiella emersonii clone report

Clone ID BeCSAS2322
Best BLASTX Match ref|YP_259732.1|
Function Description oxidoreductase, Gfo/Idh/MocA family [Pseudomonas fluorescens Pf-5]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2322
GTCCGGAATTCCTCGGGTCGACAACGCGACAACCCCCAGCAACGAGAGCG
CTGTGGCCAGCAATGCGACCCTGCGCGTGGCCTTCGGGCGGAAAAACACC
ACACCCATGACAGGCTCACTCATAGACCTTTCTCCCATTTATTATTGTTA
GGTCGTCTTGCCGTGGGGAGCCCTGAAACCTGCAATCTAGAGCGCCTTGA
GCAAGCTGGGCCATCCTAGCGGGCTTTGGAATCGTCTGACAATCGGCGCT
ACGTTATGTTTTGTTAACTGGAGGGGGTTTGAGCCAGTGCTGAATGTAGC
GCTATCAGCAGCGGTGATCGTAGAGGGGGGCTCCCTCGCCACAGGGTGAA
TGGGGAGCCCTGGAATGAATTTTTATTCTACGTGTTGAGTTTTGGGAATA
TTTATTCCATAAATAGCCCTCTCAAAACAATAATTCGAAGGAACCCGGCT
ATGCGCGAACTCGGAATCGGCCTGATTGGCACAGGCTTTATGGGGCGTGC
CCACGCTCTGGCATTCAATAACGCTCGGGCGGTGTTTGAACTGCCGGTGA
AGCTCACACTGGCCGCCCTGGCCGATGCCGATACCGAACGCGCGACACGC
TGCGCCGCGGACTGGGGGTTTGCCCAGGCCCATGGCGACTGGCAGCAGTT
GATCGACAATCCCAAGGTCGATGTCGTCGCCATCACGACCCCTAACCATT
TGCACTTCCCGATGGNCATGGCTG