Blastocladiella emersonii clone report

Clone ID BeCSAS2321
Best BLASTX Match gb|ABE79815.1|
Function Description Ankyrin [Medicago truncatula]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2321
CTCGATGCAACGCGCTCCACGGACTGGCCATCTAGCTCTCCATCATCACC
AGCAGTATGACCCAGGTCGACCTCGACGTCTCCGAGCTCCTCGCGTGCGC
GCGGTACGGCGAGCTCGACGAGCTCAAGGAGGAGGTGGCGCGGATGCAGG
CCGAGCATCCCGGGCTCACGGCCACGTCGATCCTCGGCCGCGCCAACGAC
AGCGGGAACACGGCGCTGCACATGGCGAGCGCCAACGGGCACTCGGACAT
CGTGGCGTACCTGCTCGAGCACCTGCTCGCCGCACACATCGACGCGGTCA
ACGCGCAGGGCAACACGCCGCTGCACTGGTGCGCGCTCAACGGGCACGTC
GAGGTGGCGCAGCTGCTGATCAAGGCGGGCGCCGACCTGGCCATCGTCAA
CTCGTCGCAGCACACGCCGCTCATCGAGGCCCAGGACGCCGGCCACGAGA
AGATGGCCGTCGAGCTGCTCAAGCACATGGACCCCGACATGGACGAGGGC
GCCGAGGATGCCGCCGAGGCCGGATCGCGCGAGGATGTCACAGCGCAGAC
TGAGGCGGGGGCGTCCTCGTCGTCGCCGACCGCGTGAGTGAGAACAGCAA
AGGGTATATATATATTCACAATCGTAGCG