Blastocladiella emersonii clone report

Clone ID BeCSAS2320
Best BLASTX Match gb|AAH71047.1|
Function Description MGC83676 protein [Xenopus laevis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2320
GGATTCCGGGTCGACCACGCGTCCGATCTCGGACCGTGATCACGCAACCC
GCCGCAACCCCGTCCTCTGCGCCGGCCCTGTCTCCTGCCGACCCCTGTCA
TCCGCGCTCTGCACCCATGGCGACCCGCTCGCGCACGACCCTCTTCATCG
AGCTGCGGCGATCCGTGCCGCGGCAACCGGCCGCCGGCCGCTCCGGGCGC
GGCGGCGCGCTCGAGTCCGAGAAGGTCGGGCTCATCTCCGAGCCGCACAC
GGCCGTCGATGTCGGCCACATTCGCGACCTGCCGCCCGCGTGGGTCGATA
CGGTCGAGGAGATCGAGTCAACCATTGACCGCATCCAGCAGCAGTTAAAC
AACCTCGAGACGCTGCAGAAGAAGCACCTGCTGCCGGGCTTCGACGACCG
GTCCGACACCGAGGCGAGCATCGACGCGGCGACCCACGGCGTCACCACCA
TGTTCAAGCAGTGCCAGAAGCAGATCAAGGCCTTCGAGGCCAACCATCAG
GCCGCCGCCGTCGCCGCACGGAAACGCGGCGCGCCCATGTCGCAGCAGGA
GCTCAAGCTGCACCAGAACGTCACCTCGTCGCTCGCTGCCCGCGTCTCTA
CACTGTCGACGCAGTTTCGCAAGGGCCAGTCCAACTACGTCTCGCGGTTG
AAGACCGATCCGCGAAAGCCTCCCCACTCTTCTCGCTGTC