Blastocladiella emersonii clone report

Clone ID BeCSAS2319
Best BLASTX Match ref|ZP_00768474.1|
Function Description Periplasmic binding protein [Chloroflexus aurantiacus J-10-fl]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2319
GCGCCCACGCCCCGCCCGCATGCGCCGCCCCGCCTCCGCGCTCTCAAAAC
CCGGTGCCCACCCATGCCCCTCCCCTCTCTCGCGCACCTGCTGCTGCACC
GAGACGACGGATACACATAGACGAACCGCACCGCATCCGACACCACCATG
GCGCGCACTAGCCTCGCCTCGATCCTCACCGTCCTGGCCCTCGCGGTCCT
CGCGTCCACGACGCTCGTCGCGGCGCAGAGCCCGCTCGAGGAATGCGTCA
AGACGTTCGATGCCAACAAGGACTGCTTCACGGCCAAGAGCACCAACGAG
GCGGCCAAGTACTTCAAGGTCGACTACAAGAACTACTACAAGGTGGTCAC
GGTGAACAACACGTTTGCGCCCATCACCAACTACACGCTGGTGATCCGCG
GCGCGCCCAAGACCAACCTCCCGACCAACGTGAACGGCACGTTCGAGATC
CCCGTGCGCAACGCGACCGTGTTCGACACGACGTCGGTGCCGTACCTCGA
GCTGCTCGGCAAGCGCGGGCAGATCCAGTCGGCGGCGTCGCCTAGCTACG
TGACGTCGGCGTGCTTCCAGAAGCTGATCTCGGCGGGGACCATCAAGACG
GTCGACGACAAGAACGTGACCAACGCCAACACCACGCTGGCCACGGCCGA
CGTGATCTTCTCGGGCGTCGGCCAGACGCTCAACGTGTCGACGGGCAAGT
GGGTCACGCAGGCCGCCTCGAGCGACCCGGGCGCCCTCACCGCGTCGAGT
GGCTCGAGTATTTCGCG