Blastocladiella emersonii clone report

Clone ID BeCSAS2313
Best BLASTX Match emb|CAJ42002.1|
Function Description glycogen synthase kinase [Ustilago hordei]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2313
GCTGCGTCATGGCCGAGCTCATGCTCGGCAAGCCCATGTTCCCCGGCGAG
TCGGGCGTCGACCAGCTCGTCGAGATCATCAAGGTGCTCGGCACCCCGGA
GCGCGACCAGGTGCGCGCCATGAACCCCAACTACACGGAGCACAACTTCC
CGCCCATCAAGGCCCACCCGTGGTCGCAGATCTTCACCCCCAAGACCCCG
CCCGAGGCCCTCGACATGATCGACCGCCTGCTGCGCTACGAGCCTAACAC
GCGCCCGACCGCGTGGGAGGCCCTCACCCACCCCTTCTTTGACGAGCTGC
GCCTGCCCGAGACGCGCCTGCCCTCGGGCAAGGAGCTGCCACCACTCTTT
GACTTTTCGCGCATGGAGCTGTCGATCCGCCCCGACCTCAACAAGAAGCT
CGTGCCCCCGCACGCCGAGGACGCGCTGCGCGCCCGCGGCATCGACATCA
ACAACTTTGTGCCCGAGCACATTGACAACCCGAACAACCACCTGCCGCGG
CCCGCGGGAGCGCCTGCTGGCCAGGCGTGAGCGGGGCCTCGCTCGGCTGC
CGACGTCGACGCCGTCGGCGAGCGCGTGTACACGCCCGCGGGCCTCGCTC
CTCGTGTTCCCCGCTGCGAGCGTGCCGCCTCGCCCGTCGCCGTTGTCGCT
CCTCCCGTTTTTGCTCGTGTTCCTCCTTCTCTCCCTGTTTGCTCGCTCCC
CTGTTCGCCTCGTCGTTGCACTGTGTCCCCCTCCCTTCCCGTCTGTCTGT
CTGTCTGATCGTTTGCCTGTCCCGTTTGCTGATTCCAATGAAAGTGTCTC
TGCCTCGCT