Blastocladiella emersonii clone report

Clone ID BeCSAS2312
Best BLASTX Match gb|EAR86681.1|
Function Description PWI domain containing protein [Tetrahymena thermophila SB210]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2312
CGCGCCGCATGCATCTTCGCACACCGTAACTCCCCGCAACGCCGCCACCA
TGTCGCTGCGCGGCACCGCCGTCGGGCAGAACGCGCGGTTCACGGACAAG
CAGGCCAAGCTGCTGCGCACGCTCAAGTTCCCGTCCGTGTACGCGACGCG
CGTCGACCCGTCGCGCGTCAACCTCGACGTGATGCGCGAGTGGGTCGACG
CGCGCCTCGTCGAGCTGCTCGGCATCGACGACGACATTGTCGCCCAGATG
GTCTTCGAGTACCTCGACTCCCCTGACCCCGACCCGCGCACCCTGCACAT
CAACCTCGTCGGGTTCCTCGAGGACAAGACCGCCGCCTTCATGAAGGACC
TCTGGAAGAAACTCGTCTCGGCCCAGAACTCCCCCGAGGGTATCCCCGCC
GAGCTCATTGACGCCAAGATCAAGGCGCTCCACGACCAGGTCCACAGCGA
GCAGGAGGCGCTCCGCCGCATCCAGCCCGCCCGCGAGTTCCGCACGACCG
CGAACGAGTACCACAGTCTCCCGCCTCGCCCCGCATTCCCGCGGCGCCCA
GCGGGCGACGAGCCGCCGTCGCCGCAGCAACGGTCCGA