Blastocladiella emersonii clone report

Clone ID BeCSAS2310
Best BLASTX Match ref|XP_368340.1|
Function Description hypothetical protein MG00904.4 [Magnaporthe grisea 70-15]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2310
CGTCCGCGACCTGTTCCCTGCCACCCACCACCCCCTGCAACGTATCATGT
CCGAGCTCCTGTCCAACCCGCGCGGCATCCCGCAGGCCCCCTTTGTCGAG
AAGGTCGAGGCGTACATCTCGGGCTCGGTCGAGGCCACCATGGCCAAGCT
CGACGAGATGACCAAGAAGTACAAGTTCATGGAGCAGAACCTCCGCCAGC
GCCACGCGTCGCTGTCGTCCAAGATCCCCGAGATCCGCACTACCCTGCAG
ACGGTCCGCATGCTGATTGCCCAGAACGAGTCGGGCGAGCCCCTCGAGAC
CAACTTCGAGCTCAACGACACGCTGTTTGCCAAGGCCGTGGTCGAGGCCA
CGCCGACGGTGAACATCTGGCTCGGCGCCAACGTGATGCTCGAGTACCCG
ATCGCCGAAGCCGAGGAGCTGCTCGCCACCAAGCTCGCCCAAGCAACAAC
CTCGCTGCAGCAGGTCGACGAGGACCTCGAGTTTCTCCGCGAGCAGATCA
CCACCATGGAGGTCAACGTCGCGCGCGTCTACAACTGGGACGTGCAGCAG
CGAAAGAAGGCGCCCAAGCCTGTCGCCGCCTGATCGCCTTTTCACGCCCA
GACACCTGTATCTCACACAGTACATGTATTTCACATCCC