Blastocladiella emersonii clone report

Clone ID BeCSAS2309
Best BLASTX Match ref|XP_967976.1|
Function Description PREDICTED: similar to CG16916-PA [Tribolium castaneum]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2309
TCCGGATTCCGGGTCGACCCCGCGTCCGCGACCACACACACTCTGCAACG
CAATCGACCATCATGGATGAGATCGGCATCGTGAGCTCGCCCACGGCGGC
GACGCACAAGACCGAGCTGCACGGGCTCGCCGAGTCGGACCTGTACACCA
AGCTCAAGAAGCTCGAGCGCCACCTCGAGTTCCTCGAGCTGCAGGAAGAG
TACATCAAGGACGAGCAGAAGAACCTCAAGCGCGAGCTGCTGCGCGCGCA
GGAGGAGGTGAAGCGCATCCAGTCCGTCCCCCTCGTCATTGGCCAGTTCC
TCGAGGCCATTGACGCCAACACGGGCATCGTCGGCTCCACCACGGGCTCC
AACTACCTGGTCCGCATCCTGTCGACCATCGACCGCGAGCTGCTCAAGCC
CTCGACCACGGTCGCCCTGCACCGCCACTCGAACGCGCTCGTCGAGGTGC
TCCCGCCCGAGGCCGACTCGTCCATCCAGATGCTCCAGGCCACCGAGAAG
CCTGACGTCAGCTACTCGGACGTCGGCGGCCTCGACATGCAGAAGCAGGA
GATCCGCGAGGCCGTCGAGCTGCCCCTCACCCACTTTGACCTCTACCGCC
AGATTGGCATCGACCCCCCGCGCGGCGTCCTGCTCTACGGGCCCCCTGGG
ACCGGCAAGACGATGCTGGTCAAGGCGGTGGCGAACCACACGACGGCGGC
CTTCATCCGCGTGGTCGGGTCCGAGTTTGTGCAGAAATACCTGNGCGAGG
GCCCGCGCATGGTGCGCGACGTGTTC