Blastocladiella emersonii clone report

Clone ID BeCSAS2305
Best BLASTX Match ref|XP_885099.1|
Function Description PREDICTED: similar to GRB2-related adaptor protein isoform 4 [Bos taurus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2305
CTGCAGTACGGTCCGGAATTCCGGGTCGACCCCGCGTCCGACACGCTACC
AACACGCTACACTGCTACGAATCACACGCATCGACCACCGGACCTGGTGC
AACGCGCACGGGCTATCACCACGCTACTGCTCTCGGAGAACACCGCCGCT
GCTGCCGCCATGTCGTCCGAGTGCGCGTCGCCGCTCATGTCGCCGCTGTC
GAGGAAGATGAAGACCCTGTCGATTGCGTCCACGGTCCCGTTCAAAGTGC
GCGACTTTGCCCACCCGCCGACCTCGCCGCTGCACTTCGGCGTGTACCCG
ATCACCTCGCCCACGCCCTCGACGACGTCGGACATCGACAACCTGTTCCC
GTGCCACGCGCGCGCCATGTACGACTTCGAGGCGCAGGACCCGTCCGAGC
TGAGTTTCGCCGAGGGCGCCCTCATCTACATTCTCGAGCGGAAGTACCCC
GGGTGGCTGCTCGGGATTTTGGGGGATGACGAGGGGTTGGTCCCGGAAAA
CTACGTGTGCATCGAGGACGATACGAGCGAGAACGCGTCTGAAGCCGGTG
GCGCGAGCGCGGGGTCGCGGCCAGTCTCGGGCGTCCCGCCAGAGGTCGCG
GGCGCGGGACCCGCCGAGCGGCGAGCCAGCGACGCC