Blastocladiella emersonii clone report

Clone ID BeCSAS2304
Best BLASTX Match ref|XP_746548.1|
Function Description phosphate:H symporter [Aspergillus fumigatus Af293]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2304
ATGACGAACGCTGCTGCCGCCGAGTTCGCCGAGCTCGACAGTGGCAAGGC
CACGCGCATCAACTTCAAGACCATCTTCGTCTCGGGCATCGGATTCGCAA
CCGACGCCTTCGACATCTTCGTCGTCAACCTCGCCATCCCCATGATCGCC
TACTCGTGGTTCTTCGTGCCGAACTCCAACCCGGCCAAGGCCTCGGACAT
GCCCAAGACCACCACCTCGCTGCTCAAGGCCGCCACGCAGGCCGGCACCC
TCATTGGCCAGCTCACGTTCGGCTACCTCGCCGACCGCTTCGGCCGCCGC
GCCATCTTCTCGCTCGTCCTCATCATCATGATCGTCGCCACCATCAACAC
CTCGACCGCCGCCGACACCAAGACCCCCATCGGTATCGGCCCGATCCTCG
CGTTCTGGCGTTTCGTTCTCGGCGTGGGTATTGGGGGTGATTATCCGTTG
TCGGCTTCGGTGTCGTCCGAAAACTCGGTCACGAAGACTCGTGGACTCGG
TCTGGCCGCTGTCTTCGCTATGCAGGGCGTCGGTATTCTCGTTGCGTCCC
TCGCCGGTGTCCTGACCATTCTCGGCAGCAAACCGTACCTCATGCCGCCG
CCCGACAACCAGGCCGCGTACACGCAGGGCTTCGACGGCGTCTGGCGCAT
CCTGC