Blastocladiella emersonii clone report

Clone ID BeCSAS2303
Best BLASTX Match emb|CAB59882.1|
Function Description SPAC1071.06 [Schizosaccharomyces pombe]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2303
GTCGACCCCGCGTCCGATTGCAACGCATCGACTCTCCATCATGTCACTCA
ATCGCGAGGAGCGCTACGTGGTGCTGATCCCGGGCGCCGAAGGCACCTCG
GGCGGCCTGACGGGCCCGCTTGACCCGCAGTGTCGGTTCTTCCCGTTCGA
CCCTTCGCAGCCGTCGCCCATGGAGCGCGGGATCGTGCGCGACTGGCCCG
CGCTGTGCGCGCACTGGAAGCAGGTGTACCAGCGCGACCTCGGCATCTCG
CGGCGGCAGGGCGACCACCCGGTGCTCCTGCTGGTGCCCAGCGCGTGGAC
AAAGGCCGACGTCGAGATTGCGACCAAGTTCTTCTTCGAGGAGTGCAACG
TGCCCGGGTTCGCGACGTGCCCGGCGCCCGTCGCCGCGCTGTTCGGCGTC
AACTGCGTCACGGGCATCGTCGTCGAGATCGGATACGACTGCATCGAGGT
GACGCCCGTCGTCGACGCGGTCCCGCTCAAAACGGCGGCGCGGCTGTCGC
CCGTAGGCATGGTCGACGTGGCGCGCGCGTTCCTCTCGCACCCCGACACC
GACGCCGCGACGCGCGCGATCCCCGAGTCGACGCTC