Blastocladiella emersonii clone report

Clone ID BeCSAS2302
Best BLASTX Match gb|AAW43552.1|
Function Description NBP35, putative [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2302
CCTGCAGTCCGGTCCGGAATTCCGGGTCGACCCCGCGTCCGCACCGCAGA
AACCCGAGGACGCGCCCGAGCACTGCCCCGGCGTCGAGTCGGCCGACGCG
GGCAAGTCGTCGGCGTGCGACGGGTGCCCGAACCAGCAGATCTGCGCGTC
GGGCGAGGCCGCGGGCCCGGACCCCGCCATTGCCGACATTGCGCGTCGTC
TCGCGGGCGTGCGCCGCAAGGTGCTCATTCTCTCCGGGAAGGGCGGCGTC
GGGAAGTCGACAACGGCCGCGAACCTCGCGTTTGCGCTGTCGCACGACGA
GAACACGTCGGTCGGCGTGCTGGACGTCGACATCACGGGTCCGTCGATCC
CGCTGCTGCTGGGCGTCGCCGACGACCGCGTGCACCAGACGAGTTCCGGG
TGGACGCCCGTCGCCGTCGACGAGACGCTGTCGTGTATGTCGATCGCGTT
CATGCTCCCCTCGAAAGACGACGCCGTCATCTGGCGCGGACCGAAGAAGA
ACGGCATGATCAAGCAGTTTCTGCGCGACGTCGACTGGGGCGACCAGCTC
GACTGGATGCTCGTCGACACGCCGCCCGGCACCTCGGACGAGCACCTCTC
GGTCGTCACCTACCTCAAGGACGCGGGGATCGACGGCGCCGTCCTCGTCA
CCACGCCCCAGGAGGTCGCCCTGCAGGACGTGCGCAAGGAGATCTCCT