Blastocladiella emersonii clone report

Clone ID BeCSAS2301
Best BLASTX Match gb|AAN52383.1|
Function Description ribosomal protein L9 [Branchiostoma belcheri]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2301
GGTCCGGAATTCCGGGTCGACCACGCGTCCGGTCCCAATCGGTTGGACTG
GTAACCTCGAAAAAATGAAGGACATTCTCAAGTCGCACGACGTCACCATC
CCCGAGGGCGTGACCGTCTCCTTCAAGTCCCGCGACGTCACCGTCAACGG
TCCCCGCGGCACCCTCAAGAAGTCGTTCAAGCACGTCGACTGCGAGATTG
TCCGCGTGTCCAAGACCAAGATCCGCGTCCAGGTGTACCACGGCTCGCGC
AAGCACGTCGCGTGCATCCGCACCGTCGCCTCGCACATCCAGAACATGAT
CAAGGGTGTCACCAAGGGTTTCCTGTACAAGCTCCGCCTCGTCTACGCCC
ATTTCCCCATCAACACCAACGTGACCGATGGCGGCAAGGTGATCGAGATC
CGCAACTTCCTCGGCGAGAAGGTTGTCCGCCGCGTCCCCATGCGCGCCGA
CACCGTCATCTCGGCGTCCAAGGACCAGAAGGACGAGCTCATTGTCCAGG
GCAACGACATCGAGGCTGTCTCCCAGTCGGCCGCCGACATCCAGCAGTCG
GTCCTCGTCAAGAACAAGGATATCCGTAAGTTCCTCGACGGTATCTACGT
CTCCGAGAAGTCCACCGTCGAGCTCGAGTAAGGTCGCTCTGGGTACCCTC
TCCCACTGTGCTCCCCCTAACTCGTGTGCGACCTCGTCCCTGTTCGCGCA
CTTGATCCTCGGACATGTGCGGGCAGCGAATACAAAGTTTGACCCGATTG
ATGAACC