Blastocladiella emersonii clone report

Clone ID BeCSAS2299
Best BLASTX Match ref|XP_946443.1|
Function Description PREDICTED: similar to Protein C14orf120 isoform 10 [Homo sapiens]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2299
CGGTCCGGAATTCCGGGTCGACCCCGCGTCCGACCATGAATTCTACATCC
GTCAAGCGCGCCGCCGCGGCGGCGCCCGCCGACCAATTCCTCGCGGTCGT
CAAGGAGATCCAGGCGACCGCCGCCAAGGTCCGCGACGCGGTCCCCGGCG
TGCATGAGAAGATCGCGCCGACGTCCAAGGGCCTTTCGTTCCTCGAGGTC
AAGAACCAATCGATCATCACGTACCTCATCTCGCTGTGCCACCTCATGTC
GGCCAAGCTCGACGGCCAGGAGCCCGCGGCGTGGGCGTCCATGGACGCGC
TGCTCGAGTCGCGCGTGCTGCTCGAGAAGATCAAGCCCATGGAGTCCAAG
CTCAAGTACCGCATCGACAAGCTGCTCAAGCTCGCCGAGACGGGCGAGCA
GAAGGACGCCCTGTCGTTCAAGCCCAACCTGGCCGACTTCGACGCCGACG
CGGCGGCCGACGAAATGGACGGCGGCGACTCCGAGGACGAGGAGCGGACG
GCCGCCGCCAAGGCCGGCGTGTACCGTCCGCCGAAGCTGGCCCCCGTGCG
GTACGAGGAGGGCGGTGCCGCAGCGCGCCAGCGCGTGAACCAGCGCGCCG
TGGCCGCGGCGTCGCGCTCGCGCCTGATGCGCGACCTCGAGGAGGAGTTT
GGCGACGCGCCCGAGGTCCGCACCGCGGGTCTCGTCGAGAGCGCGGCGA