Blastocladiella emersonii clone report

Clone ID BeCSAS2297
Best BLASTX Match ref|NP_009750.1|
Function Description Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl21Bp and has similarity to rat L21 ribosomal protein; Rpl21ap [Saccharomyces cerevisiae]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2297
CGGTCCGGAATTCCGGGTCGACCCCGCGTCATTGACCGACCCGGACCACC
CTTAACTCGTCGTCGTCATGCCTCACTCGTTCGGTTACCGCGCGCGCACC
CGCCACCTGTTCTCCAAGAACTTCCGCCAGCATGGCCCCGAGCACCTCTC
GACCTACATGAAGGTCTACCGTGCCGGTGACATCGTTGACATCAAGGCCA
ACGCTGCCATCCACAAGGGCATGCCCCACAAGTTCTACCACGGTCGCACC
GGTGTCGTCTACAACGTCACCAAGTCCGCTGTCGGCGTCATCGTCAACAA
GCGCGTCGGCAACCGCTTTGTCGAGAAGCGCGTCAACATCCGCATTGAGC
ACATCAAGCACTCCAAGTGCCGCGAGGACTTCCTCAAGCGCGTCAAGGAG
AACGCCGCCAAGAAGAAGGCCGCCAAGGAGGCCGGCGAGAAGGTCATCCT
CAAGCGTCTCCCCGCCCAGCCCCGCGCCAAGACCCTCGTCAAGACCGCCA
AGACCTCGATCGAGACCCTCTCCCCCATCGCCTACGAGGCCCTCGTGTAA
GACTCCCTGCCCCCACTCGCCATGGTGTCTCTTGCTCGGTCCGGCGTGCG
CTCAATACATTCCGAATGAGCTTACA