Blastocladiella emersonii clone report

Clone ID BeCSAS1310
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS1310
TGAATTCTTCATCGCCGCCGCAGGCCCGGCACCGACCCGAACCCGCGCCC
ATGGAGCGCTCCGACCGCGACGCGGGCCCCTTGCTCGCCGAGGCCACGCT
GCACCGCCTCGCGTCCGCGTCGGCCGGCTCGATCCTGACGTCGCTGCTCG
TCACCCCGCTCGATGTGGTCAAGACCCGCATGCAGCAGCAGCCCGCACCC
GGCTCGCCCGCCGCGGGAGCCCCGGGGACCGGCGCCGCACCGCGACCAGC
CGCCCCCAAGCCGCGGTGCCCGATCCCGGGGCCCGGCCGGCTCCCGCACG
CGGCTGCTGCCGGCGGCGTGGCGGGGCCCGCGCCCATCATGACGTGCTGC
CGCGAAGTCTTCTTCTCGGGCGGCAAGGAGGTGGCCTGGTTCTGCACCTC
GCGCCACGGCTTTGTCGAGCGCCCGCACACGGCCCCGCGATTGAGCCCCG
CGGCTGCAACATCTGCTACTGCGGCCCACCCGCGCGTGTCGACTGCTCCA
CGGAGCGGCGGTGCTGCCCGCGTCCATGCCGCCGCGGGTGCCGCACGGAC
GGTGTCGCTGCCACCGCCGCCGGCGCAGTCCACAGCAATGCCAGCGGGCC
AGTTTACCGGCACGTGGGACGCCATGGTCAGGATTGCG